| ROUGE |
Gene/Protein Characteristic Table for mKIAA0005 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | BC028865 |
|---|---|
| basic leucine zipper and W2 domains 1. | |
| meg01347 [Vector Info] | |
| Source : | Mouse embryonic intestinal tract |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2817 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1482 bp Genome contig ID gi65488608f_58598554 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
AAGATTTTTTTTTTTAAAATAAAGTCCATCCTTGCFlanking genome sequence
(112752 - 112801) ----+----*----+----*----+----*----+----*----+----*
ATTTAGGTTTTATAGATCAGTCTTTTTATTCCCACCCCTCCCCCAGTCGC
KIAA Alignment based on: KIAA0005 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 61..1335
Length: 424 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |