ROUGE |
Gene/Protein Characteristic Table for mFLJ00410 |
Link to : NEDO | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC014817 |
---|---|
mpj01308 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1635 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 183 bp Genome contig ID gi65551972f_57471426 PolyA signal sequence
(AGTAAA,-19) +----*----+----*----+----*----+----
GGCACAATGTCATTCCAGTAAAGCAAAAGAAATAGFlanking genome sequence
(134765 - 134814) ----+----*----+----*----+----*----+----*----+----*
ATCCTCTTTTTACTGTCATAATTTCATACGTCCTGGTTCTCAGAAGACAT
KIAA Alignment based on: FLJ00410 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 115..1452
Length: 445 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |