ROUGE

Gene/Protein Characteristic Table for mFLJ00395

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131188
Description :
Clone Name :	msj07104 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 2520 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 383 bp

Genome contig ID gi65550231f_31183382
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TCTCTCATCACTGAGGTAATAAACATGTGTCAAGT
Flanking genome sequence
(123667 - 123716)
----+----*----+----*----+----*----+----*----+----*
AAAAGCAAGAAGTAAATTACTGAGTTCTGGGGCTGGGAATGTGACTTGGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00395 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00395	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2137
Length: 711 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21438	100.0	mFLJ00395 prote...	Mus musculus
AAO17382	99.9	myosin-1F-like ...	Mus musculus
AAH46502	99.9	Myosin IF [Mus ...	Mus musculus
EDL86635	98.3	myosin IF (pred...	Rattus norvegicus
EAW68912	92.1	myosin IF, isof...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK088011	1e-21	42.7	mFLJ00293
AK220548	9.2e-08	38.1	mKIAA4211
AY205605	9.2e-07	34.4	mKIAA2034
AK122578	1.7e-06	34.2	mKIAA3005
AK173045	4.4e-06	29.3	mKIAA0866

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 657 709 PD000066 SH3

FPrintScan IPR000637 542 552 PR00929 HMG-I and HMG-Y

IPR000637 590 601 PR00929 HMG-I and HMG-Y

IPR000637 604 614 PR00929 HMG-I and HMG-Y

IPR001452 657 667 PR00452 SH3

IPR001452 671 686 PR00452 SH3

IPR001452 688 697 PR00452 SH3

IPR001452 699 711 PR00452 SH3

HMMPfam IPR001609 1 290 PF00063 Myosin head

IPR000048 307 327 PF00612 IQ calmodulin-binding region

IPR010926 329 531 PF06017 Myosin tail 2

IPR001452 657 711 PF00018 SH3

IPR011511 658 711 PF07653 Variant SH3

HMMSmart IPR001609 1 304 SM00242 Myosin head

IPR001452 657 711 SM00326 SH3

ProfileScan IPR000048 310 335 PS50096 IQ calmodulin-binding region

IPR001452 654 711 PS50002 SH3

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	657	709	PD000066	SH3
FPrintScan	IPR000637	542	552	PR00929	HMG-I and HMG-Y
IPR000637	590	601	PR00929	HMG-I and HMG-Y
IPR000637	604	614	PR00929	HMG-I and HMG-Y
IPR001452	657	667	PR00452	SH3
IPR001452	671	686	PR00452	SH3
IPR001452	688	697	PR00452	SH3
IPR001452	699	711	PR00452	SH3
HMMPfam	IPR001609	1	290	PF00063	Myosin head
IPR000048	307	327	PF00612	IQ calmodulin-binding region
IPR010926	329	531	PF06017	Myosin tail 2
IPR001452	657	711	PF00018	SH3
IPR011511	658	711	PF07653	Variant SH3
HMMSmart	IPR001609	1	304	SM00242	Myosin head
IPR001452	657	711	SM00326	SH3
ProfileScan	IPR000048	310	335	PS50096	IQ calmodulin-binding region
IPR001452	654	711	PS50002	SH3

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	383 bp
Genome contig ID	gi65550231f_31183382
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCTCTCATCACTGAGGTAATAAACATGTGTCAAGT
Flanking genome sequence (123667 - 123716)	----+--------+--------+--------+--------+----* AAAAGCAAGAAGTAAATTACTGAGTTCTGGGGCTGGGAATGTGACTTGGT

Gene/Protein Characteristic Table for mFLJ00395

Features of the cloned DNA sequence

Features of the protein sequence