ROUGE

Gene/Protein Characteristic Table for mFLJ00374

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK084014
Description :	MOB1, Mps One Binder kinase activator-like 2C.
Clone Name :	msp00355 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 677 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5 bp

Genome contig ID gi65493515f_114690157
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGGGAGATGACAGAACGGATCTGTCACTGAGTCCA
Flanking genome sequence
(102907 - 102956)
----+----*----+----*----+----*----+----*----+----*
GATCTGGATGCTGTTGCCTGTCAGATGGACCATCTGCAGACAGTGTAGCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00374 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00374	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..672
Length: 223 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH99740	2.1e-99	99.6	Mobkl2c protein...	Mus musculus
Q8BJG4	4.8e-97	100.0	Mps one binder ...	Mus musculus
XP_001162561	9.5e-96	97.3	similar to FLJ0...	Pan troglodytes
CAI14766	9.5e-96	97.3	MOB1, Mps One B...	Homo sapiens
BAC03434	1e-95	97.3	FLJ00374 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005301 38 215 PF03637 Mob1/phocein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005301	38	215	PF03637	Mob1/phocein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5 bp
Genome contig ID	gi65493515f_114690157
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGGAGATGACAGAACGGATCTGTCACTGAGTCCA
Flanking genome sequence (102907 - 102956)	----+--------+--------+--------+--------+----* GATCTGGATGCTGTTGCCTGTCAGATGGACCATCTGCAGACAGTGTAGCC

Gene/Protein Characteristic Table for mFLJ00374

Features of the cloned DNA sequence

Features of the protein sequence