ROUGE

Gene/Protein Characteristic Table for mFLJ00311

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131175
Description :	Gamma-glutamyltransferase 4 precursor.
Clone Name :	mbg09763 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4621 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 560 bp

Genome contig ID gi66880554r_154847325
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
ATTTGCAATGGGGAATTAAAGAAAGAATATTGCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCCTGACTCTGGCTTGATTTCTGTTTAACTGATGTAATAATTGCTTTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00311 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00311	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1234..1638, 3138..3587
Length: 285 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21425	3.5e-106	100.0	mFLJ00311 prote...	Mus musculus
Q99JP7	7e-46	92.5	Gamma-glutamylt...	Mus musculus
BAC27672	7e-46	92.5	unnamed protein...	Mus musculus
EDL06125	7.8e-46	92.5	gamma-glutamylt...	Mus musculus
AAK27971	7.8e-46	90.5	gamma-glutamylt...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000101 2 285 PF01019 Gamma-glutamyltranspeptidase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000101	2	285	PF01019	Gamma-glutamyltranspeptidase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	560 bp
Genome contig ID	gi66880554r_154847325
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ATTTGCAATGGGGAATTAAAGAAAGAATATTGCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCTGACTCTGGCTTGATTTCTGTTTAACTGATGTAATAATTGCTTTC

Gene/Protein Characteristic Table for mFLJ00311

Features of the cloned DNA sequence

Features of the protein sequence