ROUGE

Gene/Protein Characteristic Table for mFLJ00269

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220205
Description :
Clone Name :	msp04032 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 3631 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 73 bp

Genome contig ID gi65515060f_34805910
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTGCCTTGCCTGCATCCGGATTACCCTGGGAAATG
Flanking genome sequence
(144658 - 144707)
----+----*----+----*----+----*----+----*----+----*
GTACAAATGACTGTTGTCCTTGGATGTAATATTTTATATATATACATATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00269 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00269	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3558
Length: 1185 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD90130	100.0	mFLJ00269 prote...	Mus musculus
EDL35463	99.9	DNA segment, Ch...	Mus musculus
NP_766499	99.2	pragmin [Mus mu...	Mus musculus
Q571I4	99.2	Tyrosine-protei...	Mus musculus
BAC29528	99.2	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173328	1.7e-17	40.5	mKIAA2002

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000719 784 1104 PF00069 Protein kinase

HMMSmart IPR002290 799 1107 SM00220 Serine/threonine protein kinase

ProfileScan NULL 707 737 PS50324 NULL

IPR000719 757 1108 PS50011 Protein kinase

ScanRegExp IPR008266 932 944 PS00109 Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000719	784	1104	PF00069	Protein kinase
HMMSmart	IPR002290	799	1107	SM00220	Serine/threonine protein kinase
ProfileScan	NULL	707	737	PS50324	NULL
IPR000719	757	1108	PS50011	Protein kinase
ScanRegExp	IPR008266	932	944	PS00109	Tyrosine protein kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	73 bp
Genome contig ID	gi65515060f_34805910
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGCCTTGCCTGCATCCGGATTACCCTGGGAAATG
Flanking genome sequence (144658 - 144707)	----+--------+--------+--------+--------+----* GTACAAATGACTGTTGTCCTTGGATGTAATATTTTATATATATACATATA

Gene/Protein Characteristic Table for mFLJ00269

Features of the cloned DNA sequence

Features of the protein sequence