ROUGE

Gene/Protein Characteristic Table for mFLJ00228

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220240
Description :
Clone Name :	mic33052 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 4319 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1142 bp

Genome contig ID gi65511124f_135244272
PolyA signal sequence
(ATTAAA,-31)
+----*----+----*----+----*----+----
GCTAATTAAAGTCAGTGCTGGCAAAGGCTGAAGTC
Flanking genome sequence
(105381 - 105430)
----+----*----+----*----+----*----+----*----+----*
AGAGTGTGTGATGGATTCATGTCCTTCTGCACCAGGGGCTGAATGCTGAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00228 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00228	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1..516, 597..1094, 2665..2931, 3177..3377
Length: 494 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90165	0	100.0	mFLJ00228 prote...	Mus musculus
EDL17970	3.2e-136	86.0	ATH1, acid treh...	Mus musculus
Q8BP56	1.4e-128	68.4	Acid trehalase-...	Mus musculus
EDM11950	2.6e-116	62.2	rCG48466, isofo...	Rattus norvegicus
BAB84981	3e-98	70.2	FLJ00228 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005195 272 487 PF03632 Glycoside hydrolase family 65

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005195	272	487	PF03632	Glycoside hydrolase family 65

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1142 bp
Genome contig ID	gi65511124f_135244272
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- GCTAATTAAAGTCAGTGCTGGCAAAGGCTGAAGTC
Flanking genome sequence (105381 - 105430)	----+--------+--------+--------+--------+----* AGAGTGTGTGATGGATTCATGTCCTTCTGCACCAGGGGCTGAATGCTGAT

Gene/Protein Characteristic Table for mFLJ00228

Features of the cloned DNA sequence

Features of the protein sequence