ROUGE

Gene/Protein Characteristic Table for mFLJ00212

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK029847
Description :	niban protein.
Clone Name :	mnh23058 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 2229 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 996 bp

Genome contig ID gi65488608f_151473312
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GAAAAAAGGAATGAATAAAGCTATTTAAGTTTACC
Flanking genome sequence
(103684 - 103733)
----+----*----+----*----+----*----+----*----+----*
AAAGACTTTACCAATGTAGAAATTGTTTGATCATTCAACAAATTGTTTTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00212 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00212	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1233
Length: 410 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB17052	3e-143	100.0	Niban [Mus musc...	Mus musculus
Q3UW53	3.7e-143	100.0	Protein Niban.	Mus musculus
BAE23066	6.2e-143	99.8	unnamed protein...	Mus musculus
EDL39463	8.5e-143	99.8	niban protein [...	Mus musculus
BAE41736	9.5e-143	99.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	996 bp
Genome contig ID	gi65488608f_151473312
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAAAAAAGGAATGAATAAAGCTATTTAAGTTTACC
Flanking genome sequence (103684 - 103733)	----+--------+--------+--------+--------+----* AAAGACTTTACCAATGTAGAAATTGTTTGATCATTCAACAAATTGTTTTC

Gene/Protein Characteristic Table for mFLJ00212

Features of the cloned DNA sequence

Features of the protein sequence