ROUGE |
Gene/Protein Characteristic Table for mFLJ00207 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131156 |
---|---|
Fatty acid transport protein 3 (Fragment). | |
mph02076 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3521 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2759 bp Genome contig ID gi65492966r_90095659 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TGGAGTCATTATTTTGTAATAAACAGCTGGAGCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATCTGGCCCATCTTCGAGAGTCTGTGGGGCTGCTTGCACATGCTCCACAT
KIAA Alignment based on: FLJ00207 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..708, 933..1337, 2004..2285
Length: 465 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |