ROUGE

Gene/Protein Characteristic Table for mFLJ00162

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK029115
Description :	Lethal(3)malignant brain tumor-like 2 protein.
Clone Name :	mej01253 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 3413 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1256 bp

Genome contig ID gi65543215f_81614671
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
ATCCTTAAATGTAAATAAAAATAAAATCTTTGAAG
Flanking genome sequence
(124354 - 124403)
----+----*----+----*----+----*----+----*----+----*
AAAACAATGTGATGATATCAGATGAGTGGGCCTCGGCCTCTAGGAGCAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00162 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00162	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2157
Length: 718 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC26305	100.0	unnamed protein...	Mus musculus
P59178	99.9	Lethal(3)malign...	Mus musculus
Q3MIF2	97.4	Lethal(3)malign...	Rattus norvegicus
EDL04567	100.0	l(3)mbt-like 2 ...	Mus musculus
AAO84917	100.0	M4MBT variant B...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220350	8.6e-32	36.3	mKIAA0681
AK129443	2.4e-29	34.5	mKIAA1798
AK220408	7.1e-19	33.2	mKIAA1617

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004092 229 307 PF02820 Mbt repeat

IPR004092 342 407 PF02820 Mbt repeat

IPR004092 447 524 PF02820 Mbt repeat

IPR004092 555 626 PF02820 Mbt repeat

ScanRegExp IPR001326 35 43 PS00824 Elongation factor 1

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004092	229	307	PF02820	Mbt repeat
IPR004092	342	407	PF02820	Mbt repeat
IPR004092	447	524	PF02820	Mbt repeat
IPR004092	555	626	PF02820	Mbt repeat
ScanRegExp	IPR001326	35	43	PS00824	Elongation factor 1

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1256 bp
Genome contig ID	gi65543215f_81614671
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ATCCTTAAATGTAAATAAAAATAAAATCTTTGAAG
Flanking genome sequence (124354 - 124403)	----+--------+--------+--------+--------+----* AAAACAATGTGATGATATCAGATGAGTGGGCCTCGGCCTCTAGGAGCAGA

Gene/Protein Characteristic Table for mFLJ00162

Features of the cloned DNA sequence

Features of the protein sequence