ROUGE

Gene/Protein Characteristic Table for mFLJ00130

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220306
Description :
Clone Name :	mbg21721 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5597 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4747 bp

Genome contig ID gi65527427r_120612675
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGGACGGCCAGGGCTACACAGAGAAACCCTGTCTC
Flanking genome sequence
(99868 - 99819)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGTGAAAATTCTCTCCAAAGACACATGACTTCATAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00130 DNA sequence

KIAA	Alignment based on:
FLJ00130	DNA sequence

Features of the protein sequence	Description

Coding region: 113..847
Length: 245 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90384	2.9e-78	100.0	mFLJ00130 prote...	Mus musculus
Q6PHN1	7.7e-62	99.5	Coiled-coil dom...	Mus musculus
AAH40264	3.4e-44	75.4	Coiled-coil dom...	Homo sapiens
NP_932348	3.9e-44	75.4	coiled-coil dom...	Homo sapiens
Q2TAC2	3.9e-44	75.4	Coiled-coil dom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	4747 bp
Genome contig ID	gi65527427r_120612675
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGACGGCCAGGGCTACACAGAGAAACCCTGTCTC
Flanking genome sequence (99868 - 99819)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGTGAAAATTCTCTCCAAAGACACATGACTTCATAC

Gene/Protein Characteristic Table for mFLJ00130

Features of the cloned DNA sequence

Features of the protein sequence