ROUGE

Gene/Protein Characteristic Table for mFLJ00120

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131134
Description :	caspase recruitment domain family, member 11.
Clone Name :	mtj01003 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 4112 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 326 bp

Genome contig ID gi65498774r_139771821
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
CCGTTCTTTTTCTTGCATTAAAATTCCTCCAGTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCCTTTGCAGAGGTTCTTATCCCACAGTCTCACTAGCAGGTGTTTCCATC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00120 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00120	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 265..3786
Length: 1173 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21384	100.0	mFLJ00120 prote...	Mus musculus
AAH96592	100.0	Card11 protein ...	Mus musculus
Q8CIS0	99.6	Caspase recruit...	Mus musculus
AAN10150	99.5	caspase recruit...	Mus musculus
BAB84875	91.2	FLJ00120 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001315 42 128 PF00619 Caspase Recruitment

ProfileScan IPR001315 37 129 PS50209 Caspase Recruitment

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001315	42	128	PF00619	Caspase Recruitment
ProfileScan	IPR001315	37	129	PS50209	Caspase Recruitment

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	326 bp
Genome contig ID	gi65498774r_139771821
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- CCGTTCTTTTTCTTGCATTAAAATTCCTCCAGTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCTTTGCAGAGGTTCTTATCCCACAGTCTCACTAGCAGGTGTTTCCATC

Gene/Protein Characteristic Table for mFLJ00120

Features of the cloned DNA sequence

Features of the protein sequence