ROUGE |
Gene/Protein Characteristic Table for mFLJ00120 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131134 |
---|---|
caspase recruitment domain family, member 11. | |
mtj01003 [Vector Info] | |
Source : | Mouse adult thymus |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4112 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 326 bp Genome contig ID gi65498774r_139771821 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
CCGTTCTTTTTCTTGCATTAAAATTCCTCCAGTTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TCCTTTGCAGAGGTTCTTATCCCACAGTCTCACTAGCAGGTGTTTCCATC
KIAA Alignment based on: FLJ00120 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 265..3786
Length: 1173 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |