| ROUGE |
Gene/Protein Characteristic Table for mFLJ00102 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220304 |
|---|---|
| immune associated nucleotide family member. immune-associated nucleotide 6. |
|
| mtk00130 [Vector Info] | |
| Source : | Mouse adult thymus |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 1554 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1016 bp Genome contig ID gi65504368r_48734349 PolyA signal sequence
(AATAAA,-32) +----*----+----*----+----*----+----
CCCAATAAAGCCTTCATGTCCCATTGGTAAAAAATFlanking genome sequence
(99995 - 99946) ----+----*----+----*----+----*----+----*----+----*
TGCCTCTTTGTGATTTTTGTCTGATTTGGGGAAAGAACCTTGAACTGATT
KIAA Alignment based on: FLJ00102 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 26..517, 546..911
Length: 286 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |