ROUGE

Gene/Protein Characteristic Table for mFLJ00102

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220304
Description :	immune associated nucleotide family member. immune-associated nucleotide 6.
Clone Name :	mtk00130 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 1554 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1016 bp

Genome contig ID gi65504368r_48734349
PolyA signal sequence
(AATAAA,-32)
+----*----+----*----+----*----+----
CCCAATAAAGCCTTCATGTCCCATTGGTAAAAAAT
Flanking genome sequence
(99995 - 99946)
----+----*----+----*----+----*----+----*----+----*
TGCCTCTTTGTGATTTTTGTCTGATTTGGGGAAAGAACCTTGAACTGATT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00102 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00102	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 26..517, 546..911
Length: 286 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90383	3.4e-117	100.0	mFLJ00102 prote...	Mus musculus
AAN03835	6.3e-64	96.6	immune-associat...	Mus musculus
Q8K349	6.3e-64	96.9	GTPase IMAP fam...	Mus musculus
Q5FVN6	1.1e-53	80.3	GTPase IMAP fam...	Rattus norvegicus
EDK98565	3.1e-46	94.6	GTPase, IMAP fa...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006703 105 286 PF04548 AIG1

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006703	105	286	PF04548	AIG1

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1016 bp
Genome contig ID	gi65504368r_48734349
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- CCCAATAAAGCCTTCATGTCCCATTGGTAAAAAAT
Flanking genome sequence (99995 - 99946)	----+--------+--------+--------+--------+----* TGCCTCTTTGTGATTTTTGTCTGATTTGGGGAAAGAACCTTGAACTGATT

Gene/Protein Characteristic Table for mFLJ00102

Features of the cloned DNA sequence

Features of the protein sequence