ROUGE |
Gene/Protein Characteristic Table for mFLJ00101 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220237 |
---|---|
mid21013 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2502 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 319 bp Genome contig ID gi65511124f_135496164 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
AAGCAATGGTTGGTTCAATAAATTATGAAGTTGTCFlanking genome sequence
(115875 - 115924) ----+----*----+----*----+----*----+----*----+----*
ACTGCCTGCCTGGCCTGGCTGACCTACAACCGCCGACACAATTCCTCAGT
KIAA Alignment based on: FLJ00101 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 456..2183
Length: 575 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |