ROUGE

Gene/Protein Characteristic Table for mFLJ00086

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131127
Description :	zinc finger protein 598.
Clone Name :	mnh06358 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 3225 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 557 bp

Genome contig ID gi65550231f_22374174
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
ATCTTCAAATAAATTTATTTTGCAGTACTGCACAT
Flanking genome sequence
(112193 - 112242)
----+----*----+----*----+----*----+----*----+----*
AGCTGGTGTTCTGAGTCTCTGCCTCTGAGTGTGTCAGGAAGCCTGGGTAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00086 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00086	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2668
Length: 888 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21377	0	100.0	mFLJ00086 prote...	Mus musculus
Q80YR4	9.8e-180	96.9	Zinc finger pro...	Mus musculus
EDM03855	5.5e-169	91.6	zinc finger pro...	Rattus norvegicus
EDL22351	8.5e-161	95.7	zinc finger pro...	Mus musculus
AAH24690	1.4e-157	96.2	Zfp598 protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR001841 35 75 PS50089 Zinc finger

IPR000694 607 709 PS50099 Proline-rich region

NULL 710 721 PS50325 NULL

ScanRegExp IPR007087 195 216 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001841	35	75	PS50089	Zinc finger
IPR000694	607	709	PS50099	Proline-rich region
NULL	710	721	PS50325	NULL
ScanRegExp	IPR007087	195	216	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	557 bp
Genome contig ID	gi65550231f_22374174
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- ATCTTCAAATAAATTTATTTTGCAGTACTGCACAT
Flanking genome sequence (112193 - 112242)	----+--------+--------+--------+--------+----* AGCTGGTGTTCTGAGTCTCTGCCTCTGAGTGTGTCAGGAAGCCTGGGTAC

Gene/Protein Characteristic Table for mFLJ00086

Features of the cloned DNA sequence

Features of the protein sequence