ROUGE

Gene/Protein Characteristic Table for mFLJ00069

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK077947
Description :	CTF18, chromosome transmission fidelity factor 18 homolog. Chl12 homolog.
Clone Name :	mph01671 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3016 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 107 bp

Genome contig ID gi65550231r_23425042
PolyA signal sequence
(TATAAA,-28)
+----*----+----*----+----*----+----
GTCTATTTATAAAGTCACACCTTACAGAGAGTGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GGTCAGGCTCATAGGATGGTGCACTTGGCCTTCTCTACCCAAGGGTTGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00069 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00069	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2909
Length: 968 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC37079	100.0	unnamed protein...	Mus musculus
Q8BIW9	99.8	Chromosome tran...	Mus musculus
AAH24142	99.7	CTF18, chromoso...	Mus musculus
EDM03944	92.5	CTF18, chromoso...	Rattus norvegicus
XP_001087813	77.0	similar to CTF1...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003959 363 561 PF00004 AAA ATPase

IPR011704 364 506 PF07728 ATPase associated with various cellular activities

HMMSmart IPR003593 360 517 SM00382 AAA ATPase

ProfileScan IPR000862 477 557 PS50150 Replication factor C conserved region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003959	363	561	PF00004	AAA ATPase
IPR011704	364	506	PF07728	ATPase associated with various cellular activities
HMMSmart	IPR003593	360	517	SM00382	AAA ATPase
ProfileScan	IPR000862	477	557	PS50150	Replication factor C conserved region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	107 bp
Genome contig ID	gi65550231r_23425042
PolyA signal sequence (TATAAA,-28)	+--------+--------+----*----+---- GTCTATTTATAAAGTCACACCTTACAGAGAGTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GGTCAGGCTCATAGGATGGTGCACTTGGCCTTCTCTACCCAAGGGTTGTT

Gene/Protein Characteristic Table for mFLJ00069

Features of the cloned DNA sequence

Features of the protein sequence