Miyakogusa Predicted Gene

chr1.CM0295.1160.nc
Show Alignment:  

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr1.CM0295.1160.nc - phase: 0 
         (1839 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC003765A_C01 KMC003765A_c01                                         252   1e-66

>KMC003765A_C01 KMC003765A_c01
          Length = 407

 Score =  252 bits (127), Expect = 1e-66
 Identities = 133/135 (98%)
 Strand = Plus / Minus

                                                                        
Query: 1705 gaagatccaagggaagctattctaaaatatgctgatgttgctaaaaaggatccaaagtac 1764
            ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 407  gaagatccaagggaagctattttaaaataagctgatgttgctaaaaaggatccaaagtac 348

                                                                        
Query: 1765 attgctccagcatatgcagaaacccaacctgagcctgtgtatgcgaagtcagattctgag 1824
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 347  attgctccagcatatgcagaaacccaacctgagcctgtgtatgcgaagtcagattctgag 288

                           
Query: 1825 gatgaagagaaatga 1839
            |||||||||||||||
Sbjct: 287  gatgaagagaaatga 273


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5746
Number of Sequences: 8469
Number of extensions: 5746
Number of successful extensions: 1569
Number of sequences better than 1.0e-03: 1
Number of HSP's better than  0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1568
Number of HSP's gapped (non-prelim): 1
length of query: 1839
length of database: 5,164,774
effective HSP length: 17
effective length of query: 1822
effective length of database: 5,020,801
effective search space: 9147899422
effective search space used: 9147899422
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)