Miyakogusa Predicted Gene

chr6.LjT16B20.40.nc

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr6.LjT16B20.40.nc
         (4306 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC002184A_C01 KMC002184A_c01                                          72   1e-11
BP042006  MFBL015d08_f                                                 50   4e-05

>KMC002184A_C01 KMC002184A_c01;
          Length = 979

 Score = 71.9 bits (36), Expect = 1e-11
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                    
Query: 1017 gcagtgttgtcaaatcgcgattgcggaccatcgtggtgaggcaaaaatccgctatt 1072
            ||||||||||||||||||||| |||||  |||| |||||||| |||||||||||||
Sbjct: 5    gcagtgttgtcaaatcgcgatcgcggaaaatcgcggtgaggccaaaatccgctatt 60



 Score = 71.9 bits (36), Expect = 1e-11
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                    
Query: 1450 gcagtgttgtcaaatcgcgattgcggaccatcgtggtgaggcaaaaatccgctatt 1505
            ||||||||||||||||||||| |||||  |||| |||||||| |||||||||||||
Sbjct: 5    gcagtgttgtcaaatcgcgatcgcggaaaatcgcggtgaggccaaaatccgctatt 60


>BP042006  MFBL015d08_f;
          Length = 469

 Score = 50.1 bits (25), Expect = 4e-05
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 1451 cagtgttgtcaaatcgcgattgcggaccatcgtggtgaggcaaaaatccgcta 1503
            ||||||| |||||||||||| |||||  |||| || ||||| |||||||||||
Sbjct: 441  cagtgttatcaaatcgcgatcgcggaatatcgcggcgaggccaaaatccgcta 389



 Score = 50.1 bits (25), Expect = 4e-05
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 1018 cagtgttgtcaaatcgcgattgcggaccatcgtggtgaggcaaaaatccgcta 1070
            ||||||| |||||||||||| |||||  |||| || ||||| |||||||||||
Sbjct: 441  cagtgttatcaaatcgcgatcgcggaatatcgcggcgaggccaaaatccgcta 389