Miyakogusa Predicted Gene

chr3.CM1570.200.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr3.CM1570.200.nc
         (6543 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC002184A_C01 KMC002184A_c01                                          62   1e-08

>KMC002184A_C01 KMC002184A_c01;
          Length = 979

 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 1809 aatagcggaattttggctcaccgcgatggtccgtgatcgcgatttgacaacactg 1863
            ||||||||| ||| | |||||||||||  |||| |||||||||||||||||||||
Sbjct: 60   aatagcggattttggcctcaccgcgattttccgcgatcgcgatttgacaacactg 6



 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 4318 aatagcggatttttggctcaccgggatggtccgcgatcgtgattttacaacactg 4372
            ||||||||||||| | ||||||| |||  |||||||||| ||||| |||||||||
Sbjct: 60   aatagcggattttggcctcaccgcgattttccgcgatcgcgatttgacaacactg 6