Miyakogusa Predicted Gene

chr6.CM0037.310.nc
Show Alignment:  

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr6.CM0037.310.nc + phase: 0 /est
         (225 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC005574A_C01 KMC005574A_c01                                          60   9e-10

>KMC005574A_C01 KMC005574A_c01
          Length = 551

 Score = 60.0 bits (30), Expect = 9e-10
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 84  tatgcagcaaggtgatcaaactgtccttagcttgaggcctggtggtggacgtgg 137
           ||||||| ||||||||||||| || || |||||||||||||| ||||| |||||
Sbjct: 280 tatgcaggaaggtgatcaaaccgttctcagcttgaggcctggcggtggtcgtgg 333


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1134
Number of Sequences: 8469
Number of extensions: 1134
Number of successful extensions: 345
Number of sequences better than 1.0e-03: 1
Number of HSP's better than  0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 343
Number of HSP's gapped (non-prelim): 2
length of query: 225
length of database: 5,164,774
effective HSP length: 15
effective length of query: 210
effective length of database: 5,037,739
effective search space: 1057925190
effective search space used: 1057925190
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)