KIAA0914

Product ID	ORK00145
Accession No	AB020721
Description	family with sequence similarity 13, member A, transcript variant 4
Clone name	sj01106
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4271 bp) Predicted protein sequence (678 aa)
HaloTag ORF Clone	FHC00145
Flexi ORF Clone	FXC00145
Source
Note	We replaced hk04217, former representative clones for KIAA0914 with sj01106. (2004/1/10)

Length: 4271 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2187 bp
Genome contig ID	gi89161207r_89766520
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ACCAAGTAAGTTATATAAAATAAATTGTGTATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTTGTGTTTTCCTTTGTAATTTCCACTAACTAACTAACTAACTTATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	89866520	89963252	17	100.0	Perfect prediction

Length: 678 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX06029	0	100.0	hCG39059, isofo...	Homo sapiens
XP_001162074	0	99.7	family with seq...	Pan troglodytes
O94988	6.3e-186	96.0	Protein FAM13A1.	Homo sapiens
XP_001161414	3.6e-185	94.6	family with seq...	Pan troglodytes
XP_001162111	3.8e-185	95.7	family with seq...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	AGCTGAATGTTAAGGATGGGG
Primer_r	TAACCAGGGCACTTCCAACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 4

Experimental conditions

Panel name	GeneBridge 4
Primer_f	AGCTGAATGTTAAGGATGGGG
Primer_r	TAACCAGGGCACTTCCAACAC
PCR product length	92 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles