Order Kazusa clone(s) from : ![]() |
Product ID | ORK00904 |
---|---|
Accession No | AB051520 |
Description | phosphatase and actin regulator 1 |
Clone name | ph00321 |
Vector information | |
cDNA sequence | DNA sequence (4784 bp) Predicted protein sequence (509 aa) |
Flexi ORF Clone | FXC00904 |
Source | Human brain (hippocampus) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3200 bp |
---|---|
Genome contig ID | gi89161210f_12725879 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (658457 - 658506) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 12825879 | 13384334 | 10 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004018 | 163 | 188 | PF02755 | RPEL repeat |
IPR004018 | 447 | 472 | PF02755 | RPEL repeat | |
IPR004018 | 485 | 509 | PF02755 | RPEL repeat | |
HMMSmart | IPR004018 | 163 | 188 | SM00707 | RPEL repeat |
IPR004018 | 447 | 472 | SM00707 | RPEL repeat | |
IPR004018 | 485 | 509 | SM00707 | RPEL repeat | |
ProfileScan | IPR004018 | 163 | 188 | PS51073 | RPEL repeat |
IPR004018 | 447 | 472 | PS51073 | RPEL repeat | |
IPR004018 | 485 | 509 | PS51073 | RPEL repeat |
![]() |
Primer_f | TCCAGAAATAAGACAAGTGCC |
---|---|
Primer_r | CTGGTGTATAATGAGCTGTCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |