KIAA0232

Product ID	ORK00038
Accession No	D86985
Description	KIAA0232, transcript variant 1
Clone name	pf00983
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7840 bp) Predicted protein sequence (1402 aa)
HaloTag ORF Clone	FHC00038
Flexi ORF Clone	FXC00038
Source	Human brain (hippocampus)
Rouge ID	mKIAA0232 by Kazusa Mouse cDNA Project
Note	We replaced ha02598, former representative clones for KIAA0232 with pf00983. (2002/5/10)

Length: 7840 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3197 bp
Genome contig ID	gi89161207f_6757149
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGGAATTAAAAGAAAAATAAAAAAATATAAACTTT
Flanking genome sequence (179644 - 179693)	----+--------+--------+--------+--------+----* ATTTCTCAACATAAGTTCCATCAAGTTCAAGATACTACTATAAGACATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	6835368	6936791	10	99.2	Perfect prediction

Length: 1402 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_055558	99.9	hypothetical pr...	Homo sapiens
XP_001091530	99.1	hypothetical pr...	Macaca mulatta
XP_852872	90.8	hypothetical pr...	Canis lupus fam...
EDM00043	89.1	rCG35767 [Rattu...	Rattus norvegicus
XP_001057070	89.6	hypothetical pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 4

Experimental conditions

Panel name	Genebridge 4
Primer_f	GGCAAACGCTGAAACGCACTG
Primer_r	TCAGAACAATACAACCACGGG
PCR product length	112 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles