Gene/Protein Characteristic Table for KIAA1507
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05666
Accession No AB040940
Description upregulator of cell proliferation
Clone name hk04967
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4360 bp)
Predicted protein sequence (872 aa)
Source Human adult brain
Rouge ID mKIAA1507 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4360 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 773 bp
Genome contig ID gi89161213r_43782269
PolyA signal sequence
(AATGAA,-25)		 
+----*----+----*----+----*----+----
ATGTCTGTTAAATGAATGAGTGCACAAGTGATGGT
Flanking genome sequence
(99749 - 99700)		 
----+----*----+----*----+----*----+----*----+----*
AATGGGCAGGTTCTGCCTCTCTGTGCCTTAATTCTCCTGTTTCTCAAAGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 7 r 43882018 43912435 7 99.2 Perfect prediction
Features of the protein sequence
Description

Length: 872 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_001071132 0 99.9 up-regulated ge...
 Homo sapiens
EAW94174 0 99.9 up-regulated ge...
 Homo sapiens
Q8TCY9 0 99.9 Protein URG4; H...
 Homo sapiens
XP_519069 0 99.9 hypothetical pr...
 Pan troglodytes
AAH18426 0 99.8 Up-regulated ge...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR006073 636 656 PR00326 GTP1/OBG
IPR006073 691 706 PR00326 GTP1/OBG
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGTGAGTGTGCAGAGAAACCC
Primer_r AACTGCTGCTTGTCTCCCTAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name GeneBridge 4
Primer_f TATAGCTGCTCTCTGTCACTG
Primer_r ATCTTGAATGCTGGTCCACTG
PCR product length 171 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp