Order Kazusa clone(s) from : ![]() |
Product ID | ORK01998 |
---|---|
Accession No | AB020645 |
Description | glutaminase, transcript variant 1 |
Clone name | hk03864 |
Vector information | |
cDNA sequence | DNA sequence (4198 bp) Predicted protein sequence (677 aa) |
HaloTag ORF Clone |
FHC01998
![]() |
Flexi ORF Clone | FXC01998 |
Source | Human adult brain |
Rouge ID |
mKIAA0838
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1938 bp |
---|---|
Genome contig ID | gi89161199f_191353892 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (184005 - 184054) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 191453806 | 191537895 | 18 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 594 | 606 | PR01415 | Ankyrin |
IPR002110 | 606 | 618 | PR01415 | Ankyrin | |
HMMPfam | IPR015868 | 252 | 538 | PF04960 | Glutaminase |
IPR002110 | 593 | 626 | PF00023 | Ankyrin | |
IPR002110 | 627 | 659 | PF00023 | Ankyrin | |
HMMSmart | IPR002110 | 593 | 623 | SM00248 | Ankyrin |
IPR002110 | 627 | 656 | SM00248 | Ankyrin | |
ProfileScan | IPR002110 | 560 | 659 | PS50297 | Ankyrin |
IPR002110 | 593 | 615 | PS50088 | Ankyrin |
![]() |
Primer_f | CAAGCCATGGAGACAGGTAGC |
---|---|
Primer_r | TAGTCACACAAAGCGGGCTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAAGCCATGGAGACAGGTAGC |
Primer_r | TAGTCACACAAAGCGGGCTGC |
PCR product length | 139 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |