Order Kazusa clone(s) from : ![]() |
Product ID | ORK04311 |
---|---|
Accession No | AB023171 |
Description | myelin regulatory factor |
Clone name | hj05543s1 |
Vector information | |
cDNA sequence | DNA sequence (5926 bp) Predicted protein sequence (1183 aa) |
Source | Human adult brain |
Note | We replaced hj05543, former representative clones for KIAA0954 with hj05543s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2374 bp |
---|---|
Genome contig ID | gi51511727f_61176697 |
PolyA signal sequence (AATAAA,-30) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (135870 - 135919) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 61276697 | 61312565 | 27 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007888 | 425 | 572 | PF05224 | NDT80/PhoG like DNA-binding |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 800 | TIIALVVVMAFSVVSMSTLYVLS | 822 | PRIMARY | 23 |
---|
![]() |
Primer_f | GTTTGTTCCTGTAGTCACTGG |
---|---|
Primer_r | CACATGACAAATACCAAGCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |