KIAA1067

Gene/Protein Characteristic Table for KIAA1067

Order Kazusa clone(s) from :

Product ID	ORK00729
Accession No	AB028990
Description	exocyst complex component 7, transcript variant 1
Clone name	hj05418
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4704 bp) Predicted protein sequence (690 aa)
HaloTag ORF Clone	FHC00729
Flexi ORF Clone	FXC00729
Source	Human adult brain
Rouge ID	mKIAA1067 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4704 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2631 bp
Genome contig ID	gi51511734r_71488693
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTCATTGTAAAAATAAATGTACTTTGCACCACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGATGGAGGGAGAAGTGGTCACAGGCTCGTCAGTCTATCATCTCACAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	71588693	71611386	19	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 690 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH11045	100.0	Exocyst complex...	Homo sapiens
CAH92744	99.6	hypothetical pr...	Pongo abelii
XP_001491890	96.9	similar to exoc...	Equus caballus
CAM16800	96.6	exocyst complex...	Mus musculus
XP_001369127	94.4	similar to exoc...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004140	61	687	PF03081	Exo70 exocyst complex subunit

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	ATGAACCAGGAAGGAGAGATC
Primer_r	AACTGGAGACAATTTGGGATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	CCR
Primer_f	ATGAACCAGGAAGGAGAGATC
Primer_r	AACTGGAGACAATTTGGGATG
PCR product length	170 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp