Order Kazusa clone(s) from : ![]() |
Product ID | ORK01598 |
---|---|
Accession No | AB014537 |
Description | zinc finger, BED-type containing 4 |
Clone name | hj03305 |
Vector information | |
cDNA sequence | DNA sequence (5217 bp) Predicted protein sequence (1175 aa) |
Flexi ORF Clone | FXC01598 |
Source | Human adult brain |
Rouge ID |
mKIAA0637
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003656 | 122 | 170 | PF02892 | Zinc finger |
IPR003656 | 292 | 340 | PF02892 | Zinc finger | |
IPR003656 | 463 | 510 | PF02892 | Zinc finger | |
IPR003656 | 565 | 613 | PF02892 | Zinc finger | |
IPR008906 | 1088 | 1168 | PF05699 | HAT dimerisation | |
HMMSmart | IPR003656 | 119 | 172 | SM00614 | Zinc finger |
IPR003656 | 289 | 342 | SM00614 | Zinc finger | |
IPR003656 | 460 | 512 | SM00614 | Zinc finger | |
IPR003656 | 562 | 615 | SM00614 | Zinc finger | |
ProfileScan | IPR003656 | 119 | 176 | PS50808 | Zinc finger |
IPR003656 | 289 | 346 | PS50808 | Zinc finger | |
IPR003656 | 460 | 516 | PS50808 | Zinc finger | |
IPR003656 | 562 | 619 | PS50808 | Zinc finger |
![]() |
---|
![]() |
Primer_f | TTATGATAGGGAAGATGCGGC |
---|---|
Primer_r | AAGGTCGTAGGCAAATGAGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTATGATAGGGAAGATGCGGC |
Primer_r | AAGGTCGTAGGCAAATGAGTG |
PCR product length | 181 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |