Order Kazusa clone(s) from : ![]() |
Product ID | ORK01101 |
---|---|
Accession No | AB011170 |
Description | carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15, transcript variant 1 |
Clone name | hj03045 |
Vector information | |
cDNA sequence | DNA sequence (4712 bp) Predicted protein sequence (614 aa) |
HaloTag ORF Clone |
FHC01101
![]() |
Flexi ORF Clone | FXC01101 |
Source | Human adult brain |
Rouge ID |
mKIAA0598
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2445 bp |
---|---|
Genome contig ID | gi89161187r_125657210 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 125757210 | 125841898 | 8 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000863 | 306 | 608 | PF00685 | Sulphotransferase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 5 | CLFLYLCFPSIFCDHKAFLRFSS | 27 | SECONDARY | 23 | 2 | 133 | CSLVFGLIIMTLVMASYILSGAH | 155 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | AAAGGGTTGTGTCCAGAGCGG |
---|---|
Primer_r | CGTGTGGGTGAGTGCGTCTTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAAGGGTTGTGTCCAGAGCGG |
Primer_r | CGTGTGGGTGAGTGCGTCTTC |
PCR product length | 77 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |