KIAA1258

Product ID	ORK00784
Accession No	AB033084
Description	guanine deaminase, transcript variant 2
Clone name	hh15704
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5321 bp) Predicted protein sequence (479 aa)
HaloTag ORF Clone	FHC00784
Flexi ORF Clone	FXC00784
Source	Human adult brain
Rouge ID	mKIAA1258 by Kazusa Mouse cDNA Project

Length: 5321 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3880 bp
Genome contig ID	gi89161216f_73854220
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TCAGACAAAAATAAATGAGACTTTGTGTTTACGTT
Flanking genome sequence (202741 - 202790)	----+--------+--------+--------+--------+----* ATTTTTTGTTGTGAGTTCTCTCTGTTTGGTTTTGTTGTGAATTCTATCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	73954220	74056959	14	99.3	Perfect prediction

Length: 479 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_528320	6.5e-199	99.2	similar to guan...	Pan troglodytes
Q9Y2T3	3.4e-190	100.0	Guanine deamina...	Homo sapiens
EAW62528	3.5e-190	100.0	guanine deamina...	Homo sapiens
2UZ9	3.6e-190	100.0	HUMAN GUANINE D...	Homo sapiens
AAG40469	3e-189	99.3	guanine aminohy...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006680	98	426	PF01979	Amidohydrolase 1
HMMTigr	IPR014311	51	469	TIGR02967	Guanine deaminase

Primer_f	ATCCTAACATTGGTCTCCGTG
Primer_r	TCATTTGAACCCTGTGGACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-