Order Kazusa clone(s) from : ![]() |
Product ID | ORK00581 |
---|---|
Accession No | AB014532 |
Description | pentatricopeptide repeat domain 1 |
Clone name | hh01900 |
Vector information | |
cDNA sequence | DNA sequence (5413 bp) Predicted protein sequence (727 aa) |
Flexi ORF Clone | FXC00581 |
Source | Human adult brain |
Rouge ID |
mKIAA0632
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3228 bp |
---|---|
Genome contig ID | gi89161213r_98752584 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99714 - 99665) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 98852298 | 98874306 | 8 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002885 | 201 | 235 | PF01535 | Pentatricopeptide repeat |
IPR002885 | 275 | 309 | PF01535 | Pentatricopeptide repeat | |
IPR002885 | 548 | 582 | PF01535 | Pentatricopeptide repeat | |
IPR002885 | 615 | 649 | PF01535 | Pentatricopeptide repeat | |
HMMTigr | IPR002885 | 201 | 235 | TIGR00756 | Pentatricopeptide repeat |
IPR002885 | 275 | 309 | TIGR00756 | Pentatricopeptide repeat | |
IPR002885 | 310 | 346 | TIGR00756 | Pentatricopeptide repeat | |
IPR002885 | 548 | 582 | TIGR00756 | Pentatricopeptide repeat | |
IPR002885 | 615 | 649 | TIGR00756 | Pentatricopeptide repeat |
![]() |
---|
![]() |
Primer_f | GAGATTGACCCCAGACCTAAC |
---|---|
Primer_r | TTTGGTTGGGCTGGAATGTCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AATGGACTTCGTGAGACTCGC |
Primer_r | CAGGGGTCCAGGTGTTGCAGG |
PCR product length | 81 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |