Order Kazusa clone(s) from : ![]() |
Product ID | ORK01078 |
---|---|
Accession No | AB002382 |
Description | catenin (cadherin-associated protein), delta 1, transcript variant 4 |
Clone name | hh00733 |
Vector information | |
cDNA sequence | DNA sequence (5423 bp) Predicted protein sequence (967 aa) |
HaloTag ORF Clone |
FHC01078
![]() |
Flexi ORF Clone | FXC01078 |
Source | Human adult brain |
Rouge ID |
mKIAA0384
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000225 | 425 | 465 | PF00514 | Armadillo |
IPR000225 | 468 | 509 | PF00514 | Armadillo | |
IPR000225 | 680 | 721 | PF00514 | Armadillo | |
IPR000225 | 727 | 767 | PF00514 | Armadillo | |
HMMSmart | IPR000225 | 425 | 465 | SM00185 | Armadillo |
IPR000225 | 468 | 509 | SM00185 | Armadillo | |
IPR000225 | 510 | 567 | SM00185 | Armadillo | |
IPR000225 | 569 | 616 | SM00185 | Armadillo | |
IPR000225 | 679 | 721 | SM00185 | Armadillo | |
IPR000225 | 727 | 767 | SM00185 | Armadillo | |
IPR000225 | 817 | 859 | SM00185 | Armadillo | |
ProfileScan | IPR000225 | 436 | 473 | PS50176 | Armadillo |
IPR000225 | 479 | 522 | PS50176 | Armadillo | |
IPR000225 | 738 | 775 | PS50176 | Armadillo |
![]() |
---|
Primer_f | AAGAGAAAAGGTATGGAGCAG |
---|---|
Primer_r | GGGTAATAGAACAGCCGTGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAGAGAAAAGGTATGGAGCAG |
Primer_r | GGGTAATAGAACAGCCGTGGG |
PCR product length | 159 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |