Order Kazusa clone(s) from : ![]() |
Product ID | ORK06928 |
---|---|
Accession No | AB018256 |
Description | sorting nexin 13 |
Clone name | hg04739 |
Vector information | |
cDNA sequence | DNA sequence (6817 bp) Predicted protein sequence (945 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0713
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3977 bp |
---|---|
Genome contig ID | gi89161213r_17698991 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 17798991 | 17946616 | 25 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000342 | 486 | 570 | PD001580 | Regulator of G protein signalling |
HMMPfam | IPR003114 | 154 | 341 | PF02194 | PX-associated |
IPR000342 | 497 | 553 | PF00615 | Regulator of G protein signalling | |
IPR001683 | 631 | 744 | PF00787 | Phox-like | |
IPR013937 | 860 | 943 | PF08628 | Sorting nexin | |
HMMSmart | IPR013996 | 154 | 341 | SM00313 | PX-associated |
IPR000342 | 430 | 570 | SM00315 | Regulator of G protein signalling | |
IPR001683 | 630 | 744 | SM00312 | Phox-like | |
ProfileScan | IPR003114 | 154 | 341 | PS51207 | PX-associated |
IPR000342 | 430 | 553 | PS50132 | Regulator of G protein signalling | |
IPR001683 | 627 | 748 | PS50195 | Phox-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 22 | EGAVAAVGGGPSSFRCCYGCCHE | 44 | SECONDARY | 23 | 2 | 56 | VIMLTEASLSIWGWGSLGIVLFL | 78 | PRIMARY | 23 | 3 | 88 | YLTFYILCFVGGGLVVTLLFGKT | 110 | PRIMARY | 23 |
---|
![]() |
Primer_f | AATCCACCACTACCAAGAGAG |
---|---|
Primer_r | CACTCTGGCACTTTGTCATTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AACATCTCTTTCAGGTCTGGA |
Primer_r | CCCTAAGAGCAAAACACAGCC |
PCR product length | 208 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |