Order Kazusa clone(s) from : ![]() |
Product ID | ORK06322 |
---|---|
Accession No | AB002298 |
Description | PDZ domain containing 2 |
Clone name | hf00389s1 |
Vector information | |
cDNA sequence | DNA sequence (11700 bp) Predicted protein sequence (2847 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0300
by Kazusa Mouse cDNA Project
|
Note | We replaced hf00389, former representative clones for KIAA0300 with hf00389s1. (2003/4/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2792 bp |
---|---|
Genome contig ID | gi51511721f_31734750 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (412046 - 412095) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 31834743 | 32146794 | 24 | 99.3 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001478 | 342 | 424 | PF00595 | PDZ/DHR/GLGF |
IPR001478 | 594 | 678 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 736 | 819 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 2630 | 2692 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 2758 | 2841 | PF00595 | PDZ/DHR/GLGF | |
HMMSmart | IPR001478 | 89 | 187 | SM00228 | PDZ/DHR/GLGF |
IPR001478 | 350 | 427 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 603 | 681 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 743 | 822 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 2639 | 2715 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 2766 | 2844 | SM00228 | PDZ/DHR/GLGF | |
ProfileScan | IPR001478 | 102 | 168 | PS50106 | PDZ/DHR/GLGF |
IPR001478 | 342 | 427 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 594 | 680 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 736 | 806 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 2630 | 2702 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 2758 | 2843 | PS50106 | PDZ/DHR/GLGF | |
ScanRegExp | IPR000719 | 745 | 775 | PS00107 | Protein kinase |
![]() |
---|
Primer_f | GTGCCAATTAAGTCAACCATC |
---|---|
Primer_r | GTCCTACTAAAACTGTCATTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTGCCAATTAAGTCAACCATC |
Primer_r | GTCCTACTAAAACTGTCATTG |
PCR product length | 195 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |