Order Kazusa clone(s) from : ![]() |
Product ID | ORK00431 |
---|---|
Accession No | D63486 |
Description | malectin, transcript variant 1 |
Clone name | ha03561 |
Vector information | |
cDNA sequence | DNA sequence (6322 bp) Predicted protein sequence (315 aa) |
HaloTag ORF Clone |
FHC00431
![]() |
Flexi ORF Clone | FXC00431 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0152
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5315 bp |
---|---|
Genome contig ID | gi89161190f_119509355 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (114691 - 114740) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 119609355 | 119624044 | 5 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 20 | VVAAMLGAWAVEGTAVALLRLLL | 42 | PRIMARY | 23 | 2 | 55 | GVAGVAGAAGAGLPESVIWAVNA | 77 | SECONDARY | 23 | 3 | 291 | NSSLMFPILVAFGVFIPTLFCLC | 313 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | GATAAGAGCAGGTGATTTGGG |
Primer_r | GCACTACTGTTTCCTTGGCTG |
PCR product length | 133 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |