Order Kazusa clone(s) from : ![]() |
Product ID | ORK00031 |
---|---|
Accession No | D63879 |
Description | squamous cell carcinoma antigen recognized by T cells 3 |
Clone name | ha03253 |
Vector information | |
cDNA sequence | DNA sequence (3660 bp) Predicted protein sequence (963 aa) |
Flexi ORF Clone | FXC00031 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0156
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 768 bp |
---|---|
Genome contig ID | gi89161190r_107340596 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 107440596 | 107479060 | 19 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000504 | 706 | 777 | PF00076 | RNA recognition motif |
IPR000504 | 803 | 873 | PF00076 | RNA recognition motif | |
IPR008669 | 942 | 963 | PF05391 | Lsm interaction | |
HMMSmart | IPR003107 | 126 | 158 | SM00386 | RNA-processing protein |
IPR003107 | 164 | 195 | SM00386 | RNA-processing protein | |
IPR003107 | 201 | 237 | SM00386 | RNA-processing protein | |
IPR003107 | 324 | 356 | SM00386 | RNA-processing protein | |
IPR003107 | 359 | 391 | SM00386 | RNA-processing protein | |
IPR003107 | 394 | 430 | SM00386 | RNA-processing protein | |
IPR003107 | 487 | 520 | SM00386 | RNA-processing protein | |
IPR000504 | 705 | 778 | SM00360 | RNA recognition motif | |
IPR000504 | 802 | 874 | SM00360 | RNA recognition motif | |
ProfileScan | IPR000504 | 704 | 782 | PS50102 | RNA recognition motif |
IPR000504 | 801 | 878 | PS50102 | RNA recognition motif |
Panel name | Stanford G3 |
---|---|
Primer_f | GCTAGGACAAGGAGGAAGGTG |
Primer_r | TACTCATCCCCATCGCTCTCG |
PCR product length | 116 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |