KIAA0047

Product ID	ORK04560
Accession No	D38554
Description	charged multivesicular body protein 1A
Clone name	ha01551
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2284 bp) Predicted protein sequence (268 aa)
Source	Myeloblast cell line (KG-1)

Length: 2284 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1476 bp
Genome contig ID	gi51511732r_88138347
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGAATGCTGTTGTAAATAAACAAATGGATCCCTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTTCTCAAGCTTTGCTTTGGAGCCTTGGGTGAGCCCCTGGATGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	88238347	88251562	7	99.3	Perfect prediction

Length: 268 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW66715	5.3e-100	99.6	procollagen (ty...	Homo sapiens
AAC50775	3e-99	98.9	PRSM1.	Homo sapiens
NP_001076783	6.2e-87	98.8	chromatin modif...	Homo sapiens
EAW66716	4.7e-40	99.2	procollagen (ty...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR006025	151	160	PS00142	Peptidase M

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 16

Experimental conditions

Panel name	Genebridge 4
Primer_f	TTCCCCGACCACACCCCAATG
Primer_r	TCTCTCAGCCTCCCAGCAAGT
PCR product length	178 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles