KIAA0087

Product ID	ORK05582
Accession No	D42038
Description	Uncharacterized protein KIAA0087.
Clone name	ha01002
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4283 bp) Predicted protein sequence (165 aa)
Source	Myeloblast cell line (KG-1)

Length: 4283 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3632 bp
Genome contig ID	gi89161213r_26439265
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTCAACTAGAGTGAATAAAATTACACGATGAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGTGTGCATGTTTCCTTGTTTATTGTAATGGTTTATTTCCTATTATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	26539265	26544932	2	99.0	Perfect prediction

Length: 165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAQ96877	3.6e-57	99.3	unknown [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 7

Experimental conditions

Panel name	Stanford G3
Primer_f	CTCCGTTTCTTCCTTCCTTTG
Primer_r	TAACAATCTCCCACTACGGTC
PCR product length	465 bp
PCR conditions	95 °C15 sec62 °C120 sec32 cycles