Order Kazusa clone(s) from : ![]() |
Product ID | ORK01954 |
---|---|
Accession No | D26445 |
Description | protein phosphatase 2, regulatory subunit B', gamma |
Clone name | ha00492 |
Vector information | |
cDNA sequence | DNA sequence (3702 bp) Predicted protein sequence (484 aa) |
HaloTag ORF Clone |
FHC01954
![]() |
Flexi ORF Clone | FXC01954 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0044
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2247 bp |
---|---|
Genome contig ID | gi51511730f_101246036 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (217575 - 217624) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 101346036 | 101463609 | 13 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | ACCCCGTTCCGTAGGCAATAA |
Primer_r | GTGCTTTCCTATCGCTCTGAC |
PCR product length | 183 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |