Order Kazusa clone(s) from : ![]() |
Product ID | ORK05401 |
---|---|
Accession No | AB040968 |
Description | hyperpolarization activated cyclic nucleotide gated potassium channel 3 |
Clone name | fk12792 |
Vector information | |
cDNA sequence | DNA sequence (3522 bp) Predicted protein sequence (711 aa) |
Source | Human fetal brain |
Note | We replaced fh09002, former representative clones for KIAA1535 with fk12792. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1384 bp |
---|---|
Genome contig ID | gi89161185f_153414193 |
PolyA signal sequence (TATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (112071 - 112120) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 153514193 | 153526262 | 8 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR003938 | 25 | 34 | PR01463 | EAG/ELK/ERG potassium channel |
IPR003938 | 67 | 77 | PR01463 | EAG/ELK/ERG potassium channel | |
IPR003938 | 78 | 87 | PR01463 | EAG/ELK/ERG potassium channel | |
IPR003938 | 197 | 207 | PR01463 | EAG/ELK/ERG potassium channel | |
IPR003938 | 279 | 288 | PR01463 | EAG/ELK/ERG potassium channel | |
IPR003938 | 443 | 451 | PR01463 | EAG/ELK/ERG potassium channel | |
HMMPfam | IPR013621 | 1 | 61 | PF08412 | Ion transport N-terminal |
IPR005821 | 65 | 283 | PF00520 | Ion transport | |
IPR000595 | 383 | 468 | PF00027 | Cyclic nucleotide-binding | |
HMMSmart | IPR000595 | 365 | 478 | SM00100 | Cyclic nucleotide-binding |
ProfileScan | IPR000595 | 365 | 471 | PS50042 | Cyclic nucleotide-binding |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 25 | PYSDFRFYWDLIMLLLMVGNLIV | 47 | SECONDARY | 23 | 2 | 180 | DLASAVVRIFNLIGMMLLLCHWD | 202 | PRIMARY | 23 | 3 | 263 | WLTMLSMIVGATCYAMFIGHATA | 285 | SECONDARY | 23 |
---|
![]() |
Primer_f | CTTCTGAGTTTGCTGTTGGTG |
---|---|
Primer_r | TGGTCCCACAGTCTTTAATGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTCTGAGTTTGCTGTTGGTG |
Primer_r | TGGTCCCACAGTCTTTAATGC |
PCR product length | 171 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |