Order Kazusa clone(s) from : ![]() |
Product ID | ORK00282 |
---|---|
Accession No | AB058706 |
Description | zinc finger protein 462 |
Clone name | fj22564s1 |
Vector information | |
cDNA sequence | DNA sequence (4691 bp) Predicted protein sequence (1412 aa) |
Flexi ORF Clone | FXC00282 |
Source | Human fetal brain |
Rouge ID |
mKIAA1803
by Kazusa Mouse cDNA Project
|
Note | We replaced fj22564, former representative clones for KIAA1803 with fj22564s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 452 bp |
---|---|
Genome contig ID | gi89161216f_108629480 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (184106 - 184155) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 108729480 | 108813584 | 11 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 737 | 759 | PF00096 | Zinc finger |
IPR007087 | 897 | 919 | PF00096 | Zinc finger | |
IPR007087 | 931 | 953 | PF00096 | Zinc finger | |
IPR007087 | 1206 | 1228 | PF00096 | Zinc finger | |
IPR007087 | 1320 | 1342 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 38 | 61 | SM00355 | Zinc finger |
IPR015880 | 110 | 133 | SM00355 | Zinc finger | |
IPR015880 | 157 | 180 | SM00355 | Zinc finger | |
IPR015880 | 214 | 237 | SM00355 | Zinc finger | |
IPR015880 | 315 | 338 | SM00355 | Zinc finger | |
IPR015880 | 360 | 383 | SM00355 | Zinc finger | |
IPR015880 | 422 | 445 | SM00355 | Zinc finger | |
IPR015880 | 505 | 528 | SM00355 | Zinc finger | |
IPR015880 | 542 | 565 | SM00355 | Zinc finger | |
IPR015880 | 612 | 635 | SM00355 | Zinc finger | |
IPR015880 | 691 | 715 | SM00355 | Zinc finger | |
IPR015880 | 737 | 759 | SM00355 | Zinc finger | |
IPR015880 | 813 | 835 | SM00355 | Zinc finger | |
IPR015880 | 897 | 919 | SM00355 | Zinc finger | |
IPR015880 | 931 | 953 | SM00355 | Zinc finger | |
IPR015880 | 960 | 983 | SM00355 | Zinc finger | |
IPR015880 | 989 | 1012 | SM00355 | Zinc finger | |
IPR015880 | 1097 | 1120 | SM00355 | Zinc finger | |
IPR015880 | 1126 | 1149 | SM00355 | Zinc finger | |
IPR015880 | 1160 | 1182 | SM00355 | Zinc finger | |
IPR015880 | 1206 | 1228 | SM00355 | Zinc finger | |
IPR015880 | 1234 | 1257 | SM00355 | Zinc finger | |
IPR015880 | 1320 | 1342 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 315 | 343 | PS50157 | Zinc finger |
IPR007087 | 737 | 764 | PS50157 | Zinc finger | |
IPR007087 | 897 | 919 | PS50157 | Zinc finger | |
IPR007087 | 931 | 959 | PS50157 | Zinc finger | |
IPR007087 | 960 | 988 | PS50157 | Zinc finger | |
IPR007087 | 1206 | 1233 | PS50157 | Zinc finger | |
IPR007087 | 1234 | 1262 | PS50157 | Zinc finger | |
IPR007087 | 1320 | 1342 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 317 | 338 | PS00028 | Zinc finger |
IPR007087 | 507 | 528 | PS00028 | Zinc finger | |
IPR007087 | 739 | 759 | PS00028 | Zinc finger | |
IPR007087 | 899 | 919 | PS00028 | Zinc finger | |
IPR007087 | 1208 | 1228 | PS00028 | Zinc finger | |
IPR007087 | 1322 | 1342 | PS00028 | Zinc finger |
![]() |
Primer_f | TTAACTTGGATCAGCTGGAAC |
---|---|
Primer_r | CCCGTCCACAAAATTCACATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |