KIAA1868

Product ID	ORK04178
Accession No	AB058771
Description	armadillo repeat containing 9
Clone name	fj22550
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3748 bp) Predicted protein sequence (463 aa)
Source	Human fetal brain
Rouge ID	mKIAA1868 by Kazusa Mouse cDNA Project

Length: 3748 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2356 bp
Genome contig ID	gi89161199f_231735302
PolyA signal sequence (None)	+--------+--------+----*----+---- CCCTGCACTCCAGCCTGGGCGACAGAGACTCCGTC
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	231835302	231997420	17	98.4	Both No-hit

Length: 463 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW70956	8.2e-159	100.0	armadillo repea...	Homo sapiens
EAW70954	8.5e-159	100.0	armadillo repea...	Homo sapiens
Q7Z3E5	1e-157	99.8	LisH domain-con...	Homo sapiens
BAC32837	2.8e-122	81.2	unnamed protein...	Mus musculus
EDL40234	2.8e-122	81.2	armadillo repea...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

RT-PCR-ELISA

Experimental conditions

Primer_f	ATTCCGAAGAGCTACCAGATG
Primer_r	TTCCCCGTGTTGGTCATGATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-