Order Kazusa clone(s) from : ![]() |
Product ID | ORK00948 |
---|---|
Accession No | AB067499 |
Description | coiled-coil domain containing 85A |
Clone name | fj18220 |
Vector information | |
cDNA sequence | DNA sequence (4069 bp) Predicted protein sequence (589 aa) |
Flexi ORF Clone | FXC00948 |
Source | Human fetal brain |
Rouge ID |
mKIAA1912
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1821 bp |
---|---|
Genome contig ID | gi89161199f_56164762 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (302052 - 302101) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 56264762 | 56466812 | 6 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 72 | 211 | PD035968 | NULL |
![]() |
Primer_f | GTCAATCTCAAACAAGGTAGC |
---|---|
Primer_r | AAAACACTGAGGCTCCACTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |