KIAA1912

Product ID	ORK00948
Accession No	AB067499
Description	coiled-coil domain containing 85A
Clone name	fj18220
Vector information	The cDNA fragment was inserted at the NotI-SalI site of the ... The cDNA fragment was inserted at the NotI-SalI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was ligated at the NotI site and the 3' end of the cDNA was inserted at the SalI site of the vector. The adjacent sequences to the cDNA are as follows: AACCCTCACT AAAGGGAACA AAAGCTGGAG CTCCACCGCG GTG-5' end of cDNA, GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CGTTTTTTTT TTTTTTT-3' end of cDNA.
cDNA sequence	DNA sequence (4069 bp) Predicted protein sequence (589 aa)
HaloTag ORF Clone	FHC00948
Flexi ORF Clone	FXC00948
Source	Human fetal brain
Rouge ID	mKIAA1912 by Kazusa Mouse cDNA Project

Length: 4069 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1821 bp
Genome contig ID	gi89161199f_56164762
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CATCTTAGCAATGGTAATAAATTATTTAATCTCAC
Flanking genome sequence (302052 - 302101)	----+--------+--------+--------+--------+----* AGTGTCTTTGTCTTCTTCAAAATGTCTTTCCTAAATTGAGTCCATTTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	56264762	56466812	6	99.3	Perfect prediction

Length: 589 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96PX6	2e-173	100.0	Coiled-coil dom...	Homo sapiens
EAX00077	3.8e-173	99.8	hCG1994544, iso...	Homo sapiens
XP_525759	6.6e-171	98.6	coiled-coil dom...	Pan troglodytes
XP_001496018	1.6e-160	94.4	similar to Coil...	Equus caballus
XP_223723	7.3e-130	84.8	similar to Delt...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	72	211	PD035968	NULL

Primer_f	GTCAATCTCAAACAAGGTAGC
Primer_r	AAAACACTGAGGCTCCACTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-