Order Kazusa clone(s) from : ![]() |
Product ID | ORK05523 |
---|---|
Accession No | AB051485 |
Description | integrator complex subunit 5 |
Clone name | fj15036 |
Vector information | |
cDNA sequence | DNA sequence (2890 bp) Predicted protein sequence (908 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1698
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 163 bp |
---|---|
Genome contig ID | gi51511727r_62070905 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 62170905 | 62173794 | 1 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 751 | KLVAAAPPALCYCSVLLRGLLAA | 773 | PRIMARY | 23 | 2 | 821 | SQLAPFEVRLLLLSVWGFLREHG | 843 | SECONDARY | 23 |
---|
![]() |
Primer_f | CATCGAGGCAACACAGAACTG |
---|---|
Primer_r | GAAAACTGACCAAATCCCTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |