KIAA1931

Gene/Protein Characteristic Table for KIAA1931

Order Kazusa clone(s) from :

Product ID	ORK07599
Accession No	AB067518
Description	family with sequence similarity 193, member B
Clone name	fj14393
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4605 bp) Predicted protein sequence (514 aa)
Source	Human fetal brain
Rouge ID	mKIAA1931 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4605 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	393 bp
Genome contig ID	gi51511721r_176779397
PolyA signal sequence (GATAAA,-23)	+--------+--------+----*----+---- TTCGTGCCGAAAGATAAAGCAACATTTGGACACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTGGCATGTTGGTGATTTGTGGGTCTGGGCGGGGAGGGAGTTGAGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	176879397	176914144	12	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 514 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_061930	2.2e-148	100.0	hypothetical pr...	Homo sapiens
XP_001095406	3.5e-146	98.5	hypothetical pr...	Macaca mulatta
BAA91589	1.7e-139	100.0	unnamed protein...	Homo sapiens
BAG53200	4.1e-139	99.8	unnamed protein...	Homo sapiens
XP_001502219	3.3e-136	92.5	hypothetical pr...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CCTTCTCAAAATGGACTGGTG
Primer_r	TTCTCGACCTGTCTGCCTTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 5

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp