Order Kazusa clone(s) from : ![]() |
Product ID | ORK05678 |
---|---|
Accession No | AB046820 |
Description | family with sequence similarity 160, member B1 |
Clone name | fj10035s1 |
Vector information | |
cDNA sequence | DNA sequence (5401 bp) Predicted protein sequence (741 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1600
by Kazusa Mouse cDNA Project
|
Note | We replaced fj10035, former representative clones for KIAA1600 with fj10035s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3173 bp |
---|---|
Genome contig ID | gi89161187f_116480626 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (133838 - 133887) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 116580626 | 116614462 | 16 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GGACCAAAATTCTTAGCTCGC |
---|---|
Primer_r | TTCACTGTAACGTCTTCTGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |