|
Order Kazusa clone(s) from : |
| Product ID | ORK00869 |
|---|---|
| Accession No | AB046801 |
| Description | ANKH inorganic pyrophosphate transport regulator |
| Clone name | fj05690 |
| Vector information | |
| cDNA sequence | DNA sequence (3928 bp) Predicted protein sequence (545 aa) |
|
HaloTag ORF Clone |
FHC00869
|
| Flexi ORF Clone | FXC00869 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1581
by Kazusa Mouse cDNA Project
|
Length: 3928 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 5 | r | 14762019 | 14924725 | 12 | 99.1 | Perfect prediction |
Length: 545 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR009887 | 54 | 545 | PF07260 | Progressive ankylosis |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 139 | AVLCMVVAGAIAAVFHTLIAYSD | 161 | PRIMARY | 23 | 2 | 184 | AFLYLAAFPFMDAMAWTHAGI | 204 | SECONDARY | 21 | 3 | 213 | LVGCASISDVIAQVVFVAILLHS | 235 | PRIMARY | 23 | 4 | 244 | LIPILSLYMGALVRCTTLCLGYY | 266 | SECONDARY | 23 | 5 | 380 | FTFVCMALSLTLCFVMFWTPNVS | 402 | PRIMARY | 23 | 6 | 409 | IIGVDFAFAELCVVPLRIFSFFP | 431 | PRIMARY | 23 | 7 | 451 | FVLAPSSVLRIIVLIASLVVLPY | 473 | PRIMARY | 23 | 8 | 481 | LGVGSLLAGFVGESTMVAIAAC | 502 | SECONDARY | 22 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | GCCCACATCAAGAAGTTCACC |
|---|---|
| Primer_r | TGACTGGAACTGGGAAGAAGG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 5
Experimental conditions| Panel name | RH-map |
|---|---|
| Primer_f | ACAGGTTAAAACTCGGCTTCC |
| Primer_r | GAAATTTAAGAGGCCACCGGG |
| PCR product length | 86 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |