Order Kazusa clone(s) from : ![]() |
Product ID | ORK00222 |
---|---|
Accession No | AB037797 |
Description | arrestin domain containing 3 |
Clone name | fj04553 |
Vector information | |
cDNA sequence | DNA sequence (4131 bp) Predicted protein sequence (437 aa) |
Flexi ORF Clone | FXC00222 |
Source | Human fetal brain |
Rouge ID |
mKIAA1376
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2674 bp |
---|---|
Genome contig ID | gi51511721r_90600317 |
PolyA signal sequence (AATAAA,-32) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99982 - 99933) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 90700299 | 90714877 | 8 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTAATCTCAGGTGAACGCATC |
---|---|
Primer_r | TTCACTCCATTCTTAGCTCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |