KIAA1949

Gene/Protein Characteristic Table for KIAA1949

Order Kazusa clone(s) from :

Product ID	ORK00952
Accession No	AB075829
Description	protein phosphatase 1, regulatory subunit 18, transcript variant 1
Clone name	fj02913
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4015 bp) Predicted protein sequence (662 aa)
HaloTag ORF Clone	FHC00952
Flexi ORF Clone	FXC00952
Source	Human fetal brain
Rouge ID	mKIAA1949 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4015 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	878 bp
Genome contig ID	gi89161210r_30652199
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTTAACTTTCCATAATAAAATGGAGTTCTCTTC
Flanking genome sequence (99948 - 99899)	----+--------+--------+--------+--------+----* AACTCGTCTGCTTCTCCTTCTTTGGGAAAAAAAAAGGGTATGTGAGGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	30752147	30763069	3	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 662 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD38640	6.3e-175	99.8	putative protei...	Homo sapiens
Q5TM66	1.2e-169	96.9	Phostensin; Pro...	Macaca mulatta
CAD38613	5.1e-92	100.0	hypothetical pr...	Homo sapiens
BAC86229	2.6e-91	99.4	unnamed protein...	Homo sapiens
AAI61960	2.8e-66	75.6	RGD1309543 prot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GAAGATTCAGGGCAGACAGAC
Primer_r	CTTGGATGACCTAGGATGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 6

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp