KIAA1683

Product ID	ORK05702
Accession No	AB051470
Description	Uncharacterized protein KIAA1683.
Clone name	fh24307
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5483 bp) Predicted protein sequence (832 aa)
Source	Human fetal brain

Length: 5483 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2984 bp
Genome contig ID	gi42406306r_18128909
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCTCTGGGTCTAATGAATAAAGTCCTCCACAGCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATCTTGGGTGATGTGTTCTGGGTTAATGGAAGTGGCTTGGGTATAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	18228909	18234428	6	97.8	Internal No-hit

Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW84683	5.9e-166	97.8	hCG2001480 [Hom...	Homo sapiens
AAN09586	2.6e-22	18.2	CG32602 [Drosop...	Drosophila mela...
EED95573	1.1e-21	34.6	predicted prote...	Thalassiosira p...
EDY74106	3.9e-20	27.0	GA28568 [Drosop...	Drosophila pseu...
AAW51128	7.1e-20	30.1	minus agglutini...	Chlamydomonas i...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008165	361	445	PD003992	Protein of unknown function GLTT
ScanRegExp	IPR000005	638	682	PS00041	Helix-turn-helix

Primer_f	AGCAAATGGCAGCGAAGATAG
Primer_r	TTAGACCCAGAGAGCCATGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-